lilmaddi2006 lilmaddi2006

10-11-2022
Mathematics

contestada

a²+b²=c² to find the
base of the right triangle.
1600 ft
500 ft

Respuesta :

Otras preguntas

Item 5 Why was the growth of cash crops important to Louisiana’s economy? It created a need for a larger workforce. It made year-round harvests possible. It

3 (2x-1 ) +7 = - 44 ( solve for x)

How does the author introduce the idea of a hidden, prehistoric city in the jungle? *

Sheffield Inc. had beginning inventory of $12,000 at cost and $21,500 at retail. Net purchases were $142,872 at cost and $184,000 at retail. Net markups were $9

i need help summerizing this quicklyDrama is a specific literary genre that includes dialogue and a performance as part of his compositional body. This kind of

what happens when female rain is in the desert

If you were able to time travel back in time, in history, where would you go and why?

Denaturation of Nucleic Acids A duplex DNA oligonucleotide in which one of the strands has the sequence TAATACGACTCACTATAGGG has a melting temperature (tm) of 5

Arrange the following units in order from smallest to greatest: ounce, pound, gram, kilogram a. ounce, gram, kilogram, pound b. ounce, gram, pound, kilogram c.

How does heart failure affect the lungs? A. Blood leaves the lungs. B.Fluid can build up in the lungs. C.Carbon dioxide enters the lungs. D.Too much oxygen ente