kennettzone5907 kennettzone5907

10-11-2022
Biology

contestada

elow is the coding strand of a small gene that codes for a peptide. assume the gene has a traditional start codon. how many amino acids long is the peptide if we assume traditional start and traditional stop codon? 5' aatccgtatctatgaccgtttggaaacactaagcggtactc 3'

Respuesta :

Otras preguntas

The diagram above shows the life cycle of a ________.

(81x to the 8th power) multiplied by the power of 1/4

Fill in the blanks with the correct verb form of the verb in parenthesis. 1 Yo (comprar) compro un libro. El lunes pasado yo compré un libro. 2 Tú (limpiar) __

Tyler’s height is 57 inches. What could be his height in centimeters? Explain your reasoning. (1 inch= 2.54 cm)

... 6 2. Find the value of x in the parallelogram below. 33 16

Help me please .... I need help

Bonjour voici ma question si vous pouvez m ´ aider de rédiger un texte sur le compostage merci

8h + (-7.9d) - 14 + 5d - 3.4h

Caroline earns $106.25 for 5 hours of work. If she makes a constant hourly wage, which table represents the relationship between the number of hours she works a

Standard Form -19 - 24y+ 8y^7 help help wjeko