Seudónimo Seudónimo

11-04-2016
Mathematics

contestada

Write an inequality to compare Monday's temperature to Tuesday's. Monday: -1
Tuesday: -10

Respuesta :

katie09 katie09

11-04-2016

heres two; -1>-10 or -10<-1

Answer Link

Otras preguntas

Need help Plz!!!!Choose ONE of the three writing assignments below and write a 4-6 sentence letter. Use science vocabulary, full sentences, proper grammar and d

Describe what life was like for people of color in WWII

Find the slope of the line through the given pair of points, if possible. Based on the slope, indicate whether the line through the points rises from left to ri

What is the allele number for the following sequence? (3pts) GTCAGTCAGTCAGTCAGTCAGTCAGTCAGTCAGTCAGTCAGTCA

preguntas de un hombre muerto de horacio quiroga

Name 2 ports in East Africa where Islam's used for profitable trade post: 44 45.

Which document included the following powers? could declare war, could make treaties, could create a post office *

someone is hunting me down and is trying to murder me

What will happen to the market value of a bond if interest rates decrease? a. The market value will decrease b. The market value will increase c. The market

A client completed 2 or more repetitions in the last 2 consecutive workouts. Which of the following indicates the client needs a load progression? A. Henneman'