jeterboi
jeterboi jeterboi
  • 13-02-2019
  • Mathematics
contestada

3/20 + w + 3/20 + w (pls

Respuesta :

danielahumajova6 danielahumajova6
  • 19-02-2019

Answer:  20w + 3

 ———————

   10  

Step-by-step explanation:

Answer Link

Otras preguntas

PLZ HELP!!! ASAP!!!PLZ!!!
What are some of the responsibilities of the Arizona Governor?
how many Newton's (N) of force are needed to accelerate a 100 kg at 4 m/s2?​
What is an easy method to divide? Full explanation please. Thanks yous
Training needed to fulfill the job GCU
Please answer and thank you
A day on a distant planet observed orbiting a nearby star is 21.5 hr. Also, a year on the planet lasts 69.3 Earth days. In other words, for the purposes of unit
RNA: CATTGGCTAACGTCGATAATCGTCGGTAC 9. Which amino acids would be found in the mutation protein? Which amino acids would be found in the mutation protein
.........................................
this is a linear equation question the question is 1/3 (x + 3) - 2 (x - 5) equal to 4 whole number 1/3 find x​