shaniquecarmons shaniquecarmons
  • 12-11-2019
  • Biology
contestada

2. Use the mRNA sequence to find the DNA and complementary sequence and the
amino acid sequence.
DNA:
5'-
Comp strand: 3-
mRNA- 5'-AUGCCUACAUGUGGUGUAACCUU A-3'
Amino acids:

Respuesta :

angelbaby82
angelbaby82 angelbaby82
  • 12-11-2019
3- TACGGATGTACACCACATTGGAA -5
Answer Link

Otras preguntas

What tools would you need to use if you are going to make the measurements necessary to calculate the density of a rock
can someone please translate this​
Supporters of minimum wage believe that it provides more _____ to people with low-paying jobs. money job opportunities housing
the majority of foreign born people living in the United States today are from
What is 4,400/17,600 as a percentage
Which of the accounts below would be closed by posting a debit to the account? josh morton, drawing miscellaneous expense unearned revenue fees earned?
What does LLC stand for
what would you do if you were an adaptive specialist?
Project active examined whether primary mental abilities could be trained. which second-order ability is related to the abilities trained in active? fluid intel
what would happen to skin cells if mitosis did not ​