Jplala9 Jplala9
  • 12-06-2020
  • Mathematics
contestada

Solve x^2 + 16x + 2 =0

Respuesta :

asmalthanaa1 asmalthanaa1
  • 12-06-2020

Answer:

x = -8 + [tex]\sqrt{}[/tex]62, -8 - √ 62

Step-by-step explanation:

This is the exact form

Answer Link

Otras preguntas

Look at the long division problem shown on the right. Complete the division to determine what the remainder will be. What is the remainder? –10 –7 7 10 x + 4 St
A new raw material is available that will decrease the variable costs per unit by 20% (or $2.80). However, to process the new raw material, fixed operating cost
I will mark Brainliest What is the length of AB
PLESE HELP! Often when you buy something, you pay a percent of the price as a tax. Suppose you pay a 7% tax on an item. What percent of
could you people help me find Bella234
How do you name the median of this triangle?​
PLZ HELP FAST Which statement best describes how the spread of Islam also led to the spread of knowledge, scholarship, and learning?​ Other cultures’ ideas were
What is the allele number for the following sequence? (3pts) GTCAGTCAGTCAGTCAGTCAGTCAGTCAGTCAGTCAGTCAGTCA
a car travels 120 miles in 3 hours with a constant speed.how far will it take to travel 200 miles
please help on either of these questions, im lost. :((