sergio9000 sergio9000

12-10-2020
Biology

contestada

Translate the following DNA sequence:
ATGCCATGGCATTGA

Respuesta :

chefchinoba2020 chefchinoba2020

12-10-2020

The template DNA strand, from which the mRNA is synthesized, is 5’ CAAACTACCCTGGGTTGCCAT 3’
(RNA synthesis proceeds in a 5’ à 3’ direction, so the template strand and the mRNA will be complementary to each other)

Answer Link

Otras preguntas

if you reach a plateau period in your job

162 divided by [6 (7-4)^2 by the way the 2 is a exponent

How do you write three fourths as a fraction percent and decimal

if you go out to eat with 3 friends and your meal was $72.50, there is 6.75% sales tax and you should tip the waiter 15%. how much should each person pay

Describe the difference between saying that two segments are congruent and saying two segments have equal length

Factor completely: 3x2 + 2x - 1 Answer (3x + 1)(x + 1) (3x + 1)(x - 1) (3x - 1)(x + 1) (3x - 1)(x - 1)

Can you write an expression for the number of miles george travels in h hours, George drives 45 mi/h?

Round 2,716 to the nearest thousand

what is the lowest common multiple of two numbers that have no common factors greater than 1? give an example.

Factor completely: 3x2 + 2x - 1 Answer (3x + 1)(x + 1) (3x + 1)(x - 1) (3x - 1)(x + 1) (3x - 1)(x - 1)