Seudónimo Seudónimo

11-10-2016
Mathematics

contestada

if Jane is 9 years old and his grandfather is 63 years older than Jane how old is he

Respuesta :

Qualtsteddy Qualtsteddy

11-10-2016

Jane is nine years old

Answer Link

tibigtd tibigtd

11-10-2016

The grandfather is 72 years old

Answer Link

Otras preguntas

American children watch an average of 25 hours of television per week with a standard deviation of 8 hours. A random sample of 40 children is selected. What is

What is the focus of the Philippines k-12 art curriculum

The ticket sales at a movie theater were $3,402. Adult tickets are $11, and senior tickets are $8. The number of senior tickets sold was 27 less than twice the

A local petting zoo allows visitors to feed the goats food pellets. The petting zoo starts the month with 525.25 pounds of food pellets. Each week, the workers

50 POINTS!!!!! FILLED OUT- lord of the flies plot diagram

An illustration of how a particular DNA mutation will most likely affect the polypeptide produced is shown. (Original DNA strand) GTAGTAGTAGTAGTAGTAGTA (Mutated

Write to teach readers about Irish folklore based on the passages provided. Be sure to use information from all the articles in your essay.

I can’t figure this one out

In five to seven grammatical--and readable--sentences, please outline what you see as the best path to global sustainabiility. Your answer should be compatible

The graph shows f(x) =x the function g(x) is a transformation of f(x) =x. which function g(x) represents the transformation of f(x)