Number1tigger Number1tigger
  • 11-10-2016
  • Mathematics
contestada

What graphs the inverse of y 3x-12

Respuesta :

apologiabiology
apologiabiology apologiabiology
  • 11-10-2016
inverse is reflect across x=y line

switch and solve
y=3x-12
x=3y-12
x+12=3y
y=1/3x+4
the inverse is y=1/3x+4
Answer Link

Otras preguntas

What is the maximum number of amino acids in a peptide that would be produced from the following mRNA sequence: 5′ AAUCCGUAAAUGAGACCGUCGAUCAAUUAGCG 3′?
Which of the following theories emphasizes the interplay between the proportions in which the factors of production are available in different countries and the
A particular telephone number is used to receive both voice calls and fax messages. Suppose that 20% of the incoming calls involve fax messages, and consider a
America First Company provided the following manufacturing costs for the month of June. Direct materials cost $40,000 Janitor's salary $2,500 Property taxes $8,
Please. Help. Asap.
What function does a security certificate perform?
There are currently almost 200 independent countries in the world . True or false
one quarter of the lawn has been mown. what fraction of the lawn is left to mow?
A person functions as a redemptive communicator when his or her behavior promotes what God values in this world, even if he or she does so without manifesting G
def recursiveDigitSum(n): ''' Computes the sum of digits of a positive integer n. Returns None of n is negative. - Your solution must use recursion in order to