10srules
10srules 10srules
  • 11-10-2016
  • Mathematics
contestada

Simplify (8 + 7i) + (2 –i)

Respuesta :

ilikepandabears ilikepandabears
  • 25-09-2017
Simplify (8 + 7i) + (2 –i) 
answer:10+6i 
Answer Link
Аноним Аноним
  • 11-12-2020

Answer:

 so what you have to do is

Step-by-step explanation:

Answer Link

Otras preguntas

Write the equation of the line through (6,4) that is parallel to the line whose equation is y= 1/2 x+7. Show all work below and place it in Slope Intercept Fo
Denaturation of Nucleic Acids A duplex DNA oligonucleotide in which one of the strands has the sequence TAATACGACTCACTATAGGG has a melting temperature (tm) of 5
Find the sum write the sum as a mixed number 2 2/3 + 3 2/3
x+1=x(x-1) In standard form
2. Juanita is playing a game on a four-quadrant grid. Her game marker is at point (1.4). How should Juanita move her marker to reach point (-2.1)?! A. to the le
Under the articles of confederation a vast majority of the power lies with
A 12.0 g sample of a metal is heated to 90.0 ◦C. It is then dropped into 25.0 g of water. The temperature of the water rises from 22.5 to 25.0 ◦C. The specific
PLS HELP!! I NEED THE ANSWER What is the outside surface area of the shape, including the bottom? Note that the top is the curved part.
necesito un cuento con estas aficion, boicotear, crueldad, estimular,injusticia,lograr,publicar y timido. por favor​
As the owner of a business, you are responsible for making decisions on technological upgrades. A vendor of point of sales systems (POS) has presented a proposa