6w7gpkz65f 6w7gpkz65f

11-12-2020
Mathematics

contestada

How much does Beatriz earn per hour?

How much would Beatriz earn if she worked 7 hours?

How much does Beatriz earn per hour How much would Beatriz earn if she worked 7 hours class=

Respuesta :

gracieetaylor17 gracieetaylor17

11-12-2020

Answer:

$52.50

Step-by-step explanation:

She makes $7.50 an hour multiple that by 7 hours and you get $52.50

Answer Link

Otras preguntas

Original: 2.4 New: 0.8

Emilio buys liter bottles of shampoo when the store has the promotion shown. Write an expression in two different ways to represent the total cost 0f 3 liters o

ence B RWHS Success Academy Answer questions based on the lab activity. Throughout the reflection, make sure you have a copy of the Student Guide and your data

Find the second term, a2, of the arithmetic sequence: a₁, a2, 4.25, a4, a5,8, ...

The judge eyed the lawyer as she argued her case. This judge happened to have a scale on his bench, like the kind that balances. The lawyer closed her case and

18 is 40% of what number? Group of answer choices 7.2 40 18 45 thx!

Summarize in your own words how acid rain affects an aquatint environment

The rectangular floor of a classroom is 24 feet in length and 3o feet in width. A scale drawing of the floor has a length of 4 inches. What is the area, in squa

Some help please i have done those a long time ago can t remember

An illustration of how a particular DNA mutation will most likely affect the polypeptide produced is shown. (Original DNA strand) GTAGTAGTAGTAGTAGTAGTA (Mutated