babybluecosmetic11
babybluecosmetic11 babybluecosmetic11
  • 10-02-2021
  • Mathematics
contestada




Solve one half ÷ 8 = _

Respuesta :

colepirrone6709
colepirrone6709 colepirrone6709
  • 10-02-2021

Answer:

1/2 of 8 = 4

Step-by-step explanation:

Hope this helps

Answer Link
tiktokqueen94 tiktokqueen94
  • 10-02-2021

Answer:

1/16

Step-by-step explanation:

[tex]\frac{1}{2}[/tex]

_____

8

1/2*1/8

=[tex]\frac{1}{16}[/tex]

Hope this helps!

Brainliest? ✨

Answer Link

Otras preguntas

12. Draw an energy curve for a chemical reaction that begins at 30 kj and has an activation energy of 50kj and the reaction ends at 10 kj. Label activation ener
can someone pls help me with this i don’t understand
PLZ ANSWER Find a formula for the exponential function passing through the points ( − 2 , 5 9 ) and (2,45) y = _____
Which mRNA sequences would form a structure that is a cue for transcription termination of some genes? 5 ′ − GGCCCUUUUAGGGCCAAAAA − 3 ′ a sequence of uracil–ade
Plz Name 3 ways you can spot bullying?
For the following reaction, 53.7 grams of iron(III) oxide are allowed to react with 22.8 grams of aluminum. iron(III) oxide (s) + aluminum (s) aluminum oxide (s
Why is Harvey a good investment for farmers?
klmn is a rectangle. what is its image under a dilation with a scale factor of 1/3?
Find the intercepts of 2x-y=-4
How different are the perspectives of liberal and conservative commentators about the L.A Riots? How do they see the importance of the trial verdict in what th