cperez202682 cperez202682

12-02-2021
Mathematics

contestada

Help... anyone i just need help with these questions!?!

Help anyone i just need help with these questions class=

Respuesta :

lehcarbrownel8 lehcarbrownel8

12-02-2021

For the first one it is

Answer Link

beebee69 beebee69

12-02-2021

Yes the first one is

Answer Link

Otras preguntas

Which of these is a potential job for Lucia?

Divide the rational expressions. Write your answer in its fully factored form. Look at picture

An illustration of how a particular DNA mutation will most likely affect the polypeptide produced is shown. (Original DNA strand) GTAGTAGTAGTAGTAGTAGTA (Mutated

Find the Rate of Change

Determine if the table shows a proportional relationship.x 7.2 9.2 13.6y 1.8 2.3 3.4 Yes, it is proportional because all y over x ratios are equivalent to one h

an apple chew was selected 53 times a lemon chew was selected 3 times a peach chew was selected 3 times what's the probability

GIVING BRAINLIEST & 30 POINTS! (please do the math and don't use other sources I know answering this question means nothing to you other than points but jus

The test scores for the 10 boys in a class are 78 5879 45 39 The mean score for the 5 girls in the class is 8 Calculate the mean for this class.

On a recent restaurant survey, 45% of customers preferred sport drinks over soft drinks. Of those who preferred sport drinks, 58% also preferred coffee over tea

GIVING 70 POINTS AND I WILL MARK BRAINLIEST PLEASE HELP! :D sorry for the all caps im just rlly energetic right now A square garden is expanded to a rectangle i