TaylorTHump TaylorTHump

11-03-2021
Chemistry

contestada

how many electrons does nitrogen need to have a full outer shell

Respuesta :

aubrievernon aubrievernon

11-03-2021

Your answer would be

8

Answer Link

Otras preguntas

If the correlation between height and weight of a large group of people is 0.74, find the coefficient of determination (as a percent) and explain what it means.

A coin with a diameter 3.00 cm rolls up a 30.0 inclined plane. The coin starts out with an initial angular speed of 60.0 rad/s and rolls in a straight line wit

2(x + 14) + (2x - 14)=

Nine more than three times a number is

Question 1 with 1 blankSi usted (ir) a la playa, tenga cuidado con el sol. Question 2 with 1 blankSi tú (querer), te preparo la merienda. Question 3 with 1

Which mRNA sequences would form a structure that is a cue for transcription termination of some genes? 5 ′ − GGCCCUUUUAGGGCCAAAAA − 3 ′ a sequence of uracil–ade

Anderson is glib and manipulative. He demonstrates extreme disregard for others, a grandiose sense of self, and a willingness to kill in order to satisfy his ne

Why Programming is important ?

find the range f(x)=2x-3 for the domain {-1, 0, 4, 7}

Explain how the following factors led to the rapid settlement of Western Territories in the latter half of the 19 th century? a. The California Gold Rush b. The