petalspng petalspng
  • 10-05-2021
  • Mathematics
contestada

ressions, Equations, and Relationships - Readines
What is the approximate value of x in this equation?
6x + 14 = 7 - X

Respuesta :

342926students 342926students
  • 10-05-2021

Answer:

x=-3

Step-by-step explanation:

Answer Link

Otras preguntas

3) Given that find xiz B and 11
can someone pleaseee help me with this math question
Carbon Dioxide behaves like the glass windows in the car with the windows wound up. Explain.
Find sin(17π/12) exactly. I think it has to do something with splitting 17/12 into 1/3 + 1/4 + 5/6 and using the sin/cos angle sum identities. Though when I tri
Why did other groups needed to be targeted by the Nazis?
5. In “Young Love,” what theme is best expressed in lines 9–16? A. Having a secret love fills one with both hope and uncertainty. B. Love ceases to exist when i
Take the indicators and bring them turn by turn in contact with solution. this sentence change into past passive​
constructed response, really need this done
An illustration of how a particular DNA mutation will most likely affect the polypeptide produced is shown. (Original DNA strand) GTAGTAGTAGTAGTAGTAGTA (Mutated
Which expression has like terms? Group of answer choices 8x - 4y 8x - 4x 13c + 13d 4 + 4y thx!