25roev05 25roev05

11-02-2022
Biology

contestada

What is the mRNA transcript if the complementary DNA is TCTGAG?

Respuesta :

10818570 10818570

11-02-2022

Answer: The template DNA strand, from which the mRNA is synthesized, is 5’ CAAACTACCCTGGGTTGCCAT 3’

(RNA synthesis proceeds in a 5’ à 3’ direction, so the template strand and the mRNA will be complementary to each other)

Explanation:

Answer Link

Otras preguntas

covert 12 into a percent of 100

this is really urgent

ANSWER NEEDED ASAP | MARKING BRAINLIST | Read this passage from The Way to Rainy Mountain. In the autumn of 1874, the Kiowas were driven southward toward the St

Basketball was invented in the US in 1935 by Franklin D. Roosevelt

In the spring of 1947 a ship carried ammonium nitrate fertilizer blew up while at a harbor in Texas City, Texas

Patrick and Christian were playing on the swing. It was Christian's turn to sit on the swing, and Patrick's turn to push. Christian notices a spider on his slee

what is a monster?? write a paragraph describing someone or something that seems monstrous to you

Using the equation below, what is the correct form of the conversion factor needed to convert the number of moles of H2O to the number of moles of NH3 produced?

Explain four things that prove the colonies were not United

Consider the mendelian traits tall (D) versus dwarf (d) and violet (W) versus white (w) consider the crosses below and determine the genotypes of the parental p