TOPO13
TOPO13
11-05-2017
Mathematics
contestada
Some one please help me with this
Respuesta :
audryblackwood
audryblackwood
11-05-2017
A. Both of these have two congruent pairs of angles, 40=40 and 90=90, it also has side ES as congruent. Normally I would say ASA but since that isn't an option A is the only other one as it dose have two congruent angles
Answer Link
VER TODAS LAS RESPUESTAS ( 23+ )
Otras preguntas
Give slope for these points blah blah blah blah blah blah blah blah blah blah blah blah blah blah blah blah blah blah blah blah blah blah blah blah blah blah bl
Question 1 (100 points) (HC) Jackie Robinson's letter to President Elsenhower My dear Mr. President: I was sitting in the audience at the Summit Meeting of Negr
6. A football player runs at 9 m/s and plows into a 70 kg referee standing on the field causing the referee to fly forward at 4.0 m/s. If this were a perfectly
A group of 35 team members needs to be divided into smaller workgroups. If each group is to contain two, three, or four people, what is the smallest number of
A system of two linear equations in two variables x and y is rewritten as the following augmented matrix: [ 6 6 | -18 ] [ -4 -2 | 2 ] Use the Gauss-Jordan Eli
An illustration of how a particular DNA mutation will most likely affect the polypeptide produced is shown. (Original DNA strand) GTAGTAGTAGTAGTAGTAGTA (Mutated
b. CHALLENGE in their lifetimes, two guinea pigs produce 40 black pups and 40 white pups. On a separate paper, make a Punnett square and find the likely genotyp
Use the organizer below to describe the innovations of the following historical figures.
Please help it's due tomorrow this is for Spanish 1
What is a Physics teachers favourite number?
