jubileebug
jubileebug jubileebug
  • 11-05-2015
  • Mathematics
contestada

A pencil factory makes 50 cases of pencils in 5 hours.

How long will the pencil factory spend making 55 cases?

Respuesta :

mel2169
mel2169 mel2169
  • 13-05-2015


If a pencil factory makes 50 cases of pencils in 5 hours. Let's first find out how many cases are made per hour.

50 ÷  5 = 10 cases per hour

Now you need to know how long it will take to make 55 cases. Since we already know that it takes 5 hours to make 50 cases. So you need to know how many cases for the extra 5 cases. If it takes 1 hour to make 10 cases, it would only take 1/2 hour to make 5 cases.

So it would take 5 1/2 hours to make 55 cases.

Hope this helps. :)

Answer Link

Otras preguntas

PLEASE HELP AND I WILL GIVE U A CHOCOLATE​
RNA: CATTGGCTAACGTCGATAATCGTCGGTAC 9. Which amino acids would be found in the mutation protein? Which amino acids would be found in the mutation protein
area of right triangle
The volume of an object as a function of time calculated by V=At^3+B/t,where t is time measured in seconds and V is in cubic meters. Determine the dimension of
Who is responsible for Cassius’ premature death? IN JULIUS CEASAR
Please help!!! A sculptor is planning to make two triangular prisms out of steel. The sculptor will use ABC for the bases of one prism and DEF for the bases of
Find two rational numbers between -1,36 and -1,35​
Read the following paragraph: (1) A second reason that we should switch our school mascot from the Hilldale Chickens to the Hilldale Bobcats is that bobcats hav
what is the value of the expression 43 ^ 2 ?
Please help i will mark brainliest