avionjohnson avionjohnson

12-02-2021
Mathematics

contestada

Find the value of the trigonometric ratio.
Answer has to be a reduced ratio.
PLS HELP!!

Find the value of the trigonometric ratio Answer has to be a reduced ratio PLS HELP class=

Respuesta :

melbm2005 melbm2005

13-02-2021

Answer:

3/5

Step-by-step explanation:

I'm not completely sure but from what I see it says 'sin C ' and both 12 , 20 are on C.

so i simply just did 12/20

reduced once - 6/10

reduced twice - 3/5

Answer Link

Otras preguntas

What is the square root of -16?

Name an example of what an exclusive power of the house of representatives?

Which is the most efficient way to solve this equation? X-68 = 122

Denaturation of Nucleic Acids A duplex DNA oligonucleotide in which one of the strands has the sequence TAATACGACTCACTATAGGG has a melting temperature (tm) of 5

A candy shop charges 8.99 a pound it's competitor charges 6.50 for 12 ounces which is a better deal and by how much

Compare and contrast direct teaching, cooperative learning, mastery learning, and problem-based learning. What are the principles of each? Describe what types

The R&D department at Parabola Inc. is developing innovative methods to develop products that would reduce resource wastage. Researchers follow a systematic

which of these was most important in forming the solar system A-darkness B-evaporation C-cooling D-gravity

The point (2,0) lies on the graph of the function . y=2x^2-x-6TrueFalse

What was the leading factor in Louisiana's economic growth during the Antebellum era?